You are here
Home » Bristletails » Archaeognatha » Machilidae » Petrobiinae » Petrobius » Petrobius brevistylis - Carpenter, 1913
Bristletails
Petrobius brevistylis Carpenter, 1913
EOL Text
Distribution:
European waters (ERMS scope), Northern Hemisphere
- UNESCO-IOC Register of Marine Organisms
- Legakis, A. (2001). Insecta, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 323-324
Habitat:
Rocky shores, Atlantic coasts
- Cheng, L. (Ed.). (1976). Marine insects. North-Holland Publishing Company: Amsterdam, The Netherlands. ISBN 0-444-11213-8. XII, 581 pp.
License | http://creativecommons.org/licenses/by/4.0/ |
Rights holder/Author | This work is licensed under a Creative Commons Attribution-Share Alike 4.0 License |
Source | http://www.marinespecies.org/aphia.php?p=taxdetails&id=118127 |
Habitat:
littoral zone
- van der Land, J. (ed). (2008). UNESCO-IOC Register of Marine Organisms (URMO).
License | http://creativecommons.org/licenses/by/4.0/ |
Rights holder/Author | This work is licensed under a Creative Commons Attribution-Share Alike 4.0 License |
Source | http://www.marinespecies.org/aphia.php?p=taxdetails&id=118127 |
Statistics of barcoding coverage: Petrobius brevistylis:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Barcode data: Petrobius brevistylis:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CGACGATGATTATTTTCAACAAATCATAAGGATATTGGAACCTTATATTTACTATTTGGTGTTTGAGCAGGGATAGTAGGAACATCTCTTAGTGTTCTTATCCGAACTGAACTAGGACAACCAGGAAGTTTGATTGGGGAC---GATCAAATTTATAATGTTATCGTTACCGCTCATGCCTTCGTTATAATCTTCTTTATAGTAATGCCTATTATAATTGGCGGCTTTGGTAACTGATTAGTACCTTTGATACTAGGAGCACCGGACATAGCTTTTCCACGATTAAACAACATAAGATTCTGACTATTGCCGCCCTCTCTTTTACTGCTTTTAAGAGGTAGTATTGTAAAAAATGGGGCTGGAACTGGTTGAACGGTTTACCCTCCCCTATCTGCAGGAATTGCTCATGCCGGCGGGGCCGTAAATTTATCTATTTTTTCGCTGCATTTAGCTGGGGCCTCCTCAATCTTAGGAGCAGCAAACTTCATTACAACAGTAATTAATATACGGCCCAGGGGAATAACACTAGACCGAATACCCCTTTTCGTCTGATCAGTATTTATNACCGCAATCTTACTACTTCTATCTTTACCGGTTTTAGCGGGAGCTATTACTATACTACTAACAGACCGAAACTTAAATACTTCATTTTTTGACCCTGCTGGGGGGGGAGATCCTATTCTCTATCAACACCTATTCTGATTCTTCGGCCATCCTGAAGTTTACATTTTAATTCTACCGGGATTTGGTATTATTTCACACATCATTAGCCAGGAGAGCGGGAAAAAAGAAGCATTTGGTAATTTAGGTATAATTTATGCTATACTAGCCATTGGTTTACTAGGGTTCGTTGTATGAGCTCATCACATATTTACAGTAGGAATAGATGTAGATACTCGCG
-- end --
-- end --